Primer3

Per-Sequence Inputs

Global Parameters

Internal Oligo Per-Sequence Inputs

Internal Oligo Global Parameters

Nucleotide positions are now 1-based by default, and you can specify the number of primer pairs to return.

This primer-picking program does not screen for interspersed repeats (e.g. ALUs in humans, B1s, B2s in rodents, etc.) or for vector contamination. Please pre-screen your input sequence as appropriate. Sequence quality is also an important factor that Primer cannot assess. See Cautions.

What if no primers are found?

Sequence

The sequence from which to choose primers. The sequence must be presented 5' -> 3' (see the discussion of the 3' self-complementarity parameters). The bases may be upper or lower case. Whitespace characters are ignored, and any other unrecognized character is treated as N.

Included Region

A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form

<start>,<length>

where <start> is the 1-based index of the first base to consider, and <length> is the number of subsequent bases in the primer-picking region.

Target

If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of

<start>,<length>

pairs where <start> is the (1-based) index of the first base of a Target, and <length> is its length.

Excluded Region

Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of

<start>,<length>

pairs where <start> is the (1-based) index of the first base of the excluded region, and <length> is its length. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs.

Product Size Range

The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form

<x>-<y>

where an <x>-<y> pair is a legal range of lengths for the product. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100-150. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100-150 200-250. Primer favors ranges to the left side of the parameter string. Primer will return legal primers pairs in the first range regardless the value of the objective function for these pairs. Only if there are an insufficient number of primers in the first range will Primer return primers in a subsequent range.

Pick Internal Oligo

If the associated value is non-0, then Primer will attempt to pick an internal oligo. Briefly, an "internal oligo" is intended to be used as a hybridization probe to detect the PCR product after amplification. Enter parameters at Internal Oligo Per-Sequence Inputs.

CG Clamp

Require the specified number of consecutive Gs and Cs at the 3' end of both the left and right primer. (This parameter has no effect on the internal oligo if one is requested.)

Optimum Primer Size

Optimum length (in bases) of a primer oligo. Primer will attempt to pick primers close to this length.

Minimum Primer Size

Minimum acceptable length of a primer.

Maximum Primer Size

Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which Primer3's melting-temperature is valid.

Optimum Tm

Optimum melting temperature(Celsius) for a primer oligo. Primer3 will try to pick primers with melting temperatures are close to this temperature. The oligo melting temperature formula in Primer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion.

Minimum Tm

Minimum acceptable melting temperature(Celsius) for a primer oligo.

Maximum Tm

Maximum acceptable melting temperature(Celsius) for a primer oligo.

Maximum Tm Difference

Maximum acceptable (unsigned) difference between the melting temperatures of the left and right primers.

Minimum GC Content

Minimum allowable percentage of Gs and Cs in any primer.

Maximum GC Content

Maximum allowable percentage of Gs and Cs in any primer generated by Primer.

Salt Concentration

The millimolar concentration of salt (usually KCl) in the PCR. Primer uses this argument to calculate oligo melting temperatures.

Annealing Oligo Concentration

The nanomolar concentration of annealing oligos in the PCR. Primer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 12) where a suitable value (for a lower initial concentration of template) is "empirically determined". The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures.

Maximum Ns Accepted

Maximum number of unknown bases (N) allowable in any primer.

Maximum Complementarity

The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between left and right primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment

5' ATCGNA 3'
   || | |
3' TA-CGT 5'

is allowed (and yields a score of 1.75), but the alignment

5' ATCCGNA 3'
   ||  | |
3' TA--CGT 5'

is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos.

Maximum 3' Complementarity

The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between left and right primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example

5' ATGCCCTAGCTTCCGGATG 3'
             ||| |||||
          3' AAGTCCTACATTTAGCCTAGT 5'

or

5` AGGCTATGGGCCTCGCGA 3'
               ||||||
            3' AGCGCTCCGGGTATCGGA 5'

The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5'->3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment.

Maximum Poly-X

The maximum allowable length of a mononucleotide repeat, for example AAAAAA.

Liberal Base

This parameter provides a quick-and-dirty way to get Primer3 to accept IUB / IUPAC codes for ambiguous bases (i.e. by changing all unrecognized bases to N). If you wish to include an ambiguous base in an oligo, you must set Maximum Ns Accepted to a non-0 value. Perhaps '-' and '* ' should be squeezed out rather than changed to 'N', but currently they simply get converted to N's. The authors invite user comments.

Number To Return

The maximum number of primer pairs to return. Primer pairs returned are sorted by their "quality", in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time.

First Base Index

This parameter is the index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) In the WWW interface this parameter defaults to 1.